Advertisment ACS-IndiaSymposium
 
Journal of Pharmaceutical Negative Results
  Print this page Email this page Small font sizeDefault font sizeIncrease font size 
Search Article 
  
Advanced search 
 Home | About us | Editorial board | Search | Ahead of print | Current issue | Archives | Submit article | Instructions | Subscribe | Contacts  
 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2014  |  Volume : 5  |  Issue : 1  |  Page : 50-55  

Incidence of new onset of type-2 diabetes with the use of atenolol for treatment of hypertension in north indian population: No role of irs-1 and kir 6.2 Gene polymorphism


1 Department of Pharmacology, Seth G.L. Bihani S.D College of Technical Education, Sri Ganganagar, Rajasthan, India
2 Department of Biotechnology, Punjabi University, Patiala, Punjab, India
3 Department of Pharmaceutical Sciences and Drug Research, Punjabi University, Patiala, Punjab, India

Date of Web Publication16-Jul-2014

Correspondence Address:
Rajesh K Goel
Department of Pharmaceutical Sciences and Drug Research, Punjabi University, Patiala 147 002
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0976-9234.136797

Rights and Permissions
   Abstract 

Introduction: Previous research has suggested that β1 adreno-receptor blockers commonly used for management of hypertension may promote new onset of type-2 diabetes mellitus. The objective of this study is to evaluate the role of insulin receptor substrate-1 (IRS-1) gene and pancreatic ATP-sensitive potassium inward rectifying channel (Kir 6.2) genetic polymorphism in induction of diabetes mellitus with chronic use of β1 blocker. Materials and Methods: A total of 150 patients with essential hypertension aged between 17 and 65 years who were diagnosed with essential hypertension and prescribed atenolol therapy, were recruited. Of these, only 100 patients responding to atenolol were followed-up for 12 months for monitoring blood glucose level every month. The IRS-1 and pancreatic ATP-sensitive potassium channel Kir 6.2 (E23K) gene polymorphism were genotyped using genomic DNA extracted from the whole blood of the recruited patients by polymerase chain reaction and restriction fragment length polymorphism. Results: This study revealed that among the 100 patients responding to atenolol 27% showed a significant increase in the fasting blood sugar. Genotyping study of the recruited patients revealed a difference in allelic frequencies for IRS-1 (Gly972Arg) and pancreatic ATP-sensitive potassium channel Kir 6.2 (E23K) variants. However, allelic distribution between the hypertensive patients on atenolol showing hyperglycemia and normoglycemia was not significantly different for these genes. Conclusion: Thus, showing no correlation, for incidence of diabetes post atenolol therapy in the studied population with these gene polymorphisms.

Keywords: Atenolol, insulin receptor substrate-1, Kir 6.2 gene polymorphism, new onset of diabetes mellitus


How to cite this article:
Bhardwaj S, Balgir PP, Goel RK. Incidence of new onset of type-2 diabetes with the use of atenolol for treatment of hypertension in north indian population: No role of irs-1 and kir 6.2 Gene polymorphism. J Pharm Negative Results 2014;5:50-5

How to cite this URL:
Bhardwaj S, Balgir PP, Goel RK. Incidence of new onset of type-2 diabetes with the use of atenolol for treatment of hypertension in north indian population: No role of irs-1 and kir 6.2 Gene polymorphism. J Pharm Negative Results [serial online] 2014 [cited 2019 Nov 15];5:50-5. Available from: http://www.pnrjournal.com/text.asp?2014/5/1/50/136797


   Introduction Top


During the past decade, several studies have shown that a large proportion of patients with hypertension are resistant to insulin stimulated glucose uptake. [1],[2],[3],[4] Evidence of a relationship between insulin resistance and hypertension is increasing. [5] It is also becoming increasingly clear that antihypertensive medication have disparate effects on insulin sensitivity in patients with essential hypertension. [6] Some antihypertensives are associated with adverse metabolic effects including hyperglycemia, hypertriglyceridemia, and hyperuricemia. [7] Discussions regarding the use of antihypertensive agents and association of diabetes has focused on the negative metabolic effects of β-blockers. [8] Treatment with β-blockers increases insulin resistance, [9],[10] thereby increasing the risk of developing type 2 diabetes mellitus or impaired glucose tolerance. [11],[12],[13],[14],[15] Non-cardiac effects of atenolol point to a wider range of side-effects. [16]

Many candidate genes for type-2 diabetes have been proposed based on their role in insulin action or insulin resistance. [17],[18] A meta-analysis of 32 case-controlled studies looking into association of insulin receptor substrate-1 (IRS-1) G972R polymorphism and type-2 diabetes proved to be inconclusive. [19] Since therapy with β-blockers has been shown to inhibit pancreatic insulin secretion, peripheral glucose utilization [20] and reduced insulin clearance [13] Therefore, it is hypothesized that antihypertensive-induced adverse metabolic effects, may be due to polymorphism of the IRS-1 and pancreatic ATP-sensitive potassium channel Kir 6.2 genes.

The gene encoding the IRS-1 protein has been localized to chromosome 2q35-q36.1 and has been studied extensively. [21] IRS-1 is a signaling protein that acts as a docking and activation site for multiple signaling molecules that control cellular growth and glucose metabolism. [22] This gene encodes a protein, which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type 2 diabetes and susceptibility to insulin resistance. One of the most common mutations in the IRS-1 gene is at codon 972, where a point mutation G - A causes a change of glycine codon -GGG to arginine -AGG resulting in a non-synonymous amino acid change (Gly972Arg) at this position in the polypeptide chain. [23],[24]

The ATP-sensitive potassium (KATP) channel is a key component regulating the release of insulin to maintain glucose homeostasis. [25],[26] The KATP channel is a hetero-octameric protein complex comprised of the pore-forming inward-rectifier Kir 6.2 subunit coupled to the high-affinity sulfonylurea receptor subunit. [27],[28] E23K polymorphism in KCNJ11 has been most extensively studied in classical form of type 2 diabetes. E23K is a missense single nucleotide polymorphism (SNP) (GAG → AAG) located in the cytosolic proximal (5') N- terminal of the Kir 6.2 subunit and results in the substitution of glutamate (E) with lysine (K). [29] Therefore, this study was undertaken to assess the correlation of adverse metabolic effects if any, of atenolol among the hypertensive patients from North Western India; with IRS-1 (rs 1801278; Gly972Arg) and pancreatic ATP-sensitive potassium channel Kir 6.2 (rs 5219; E23K) gene polymorphisms.


   Materials and methods Top


Subjects

Males or females (N = 150; 86 male, 64 female) with mild to moderate essential hypertension, of Asian Indian ethnicity residing at Sriganganagar, Rajasthan, North Western India were being recruited to participate in this study as per the following criteria:

Inclusion criteria

  • Age 17-65 years
  • Average home diastolic blood pressure (DBP) >85 mm Hg and office DBP >90 mm Hg.


Exclusion criteria

  • Office or average home DBP >110 mm Hg
  • Office or average home systolic blood pressure >180 mm Hg
  • Secondary forms of hypertension (including sleep apnea)
  • Diabetes mellitus (type 1 or 2) or screening fasting blood glucose >120 mg/dL
  • Pregnancy or lactation
  • Chronic treatment with blood pressure (BP)-elevating drugs (including nonsteroidal anti-inflammatory drugs, cyclooxygenase-2 inhibitors, and oral contraceptives)
  • Drug or alcohol use likely to affect study protocol adherence.


Protocol

The study protocol was approved by the Institutional Ethics Committee for human participants of Seth G.L. Bihani S.D. College technical education Sri Ganganagar, Rajasthan vide No. 1/19-02-2008. The subjects were followed-up for 12 months for monitoring of fasting blood glucose every month. Criteria for development of glucose metabolic dysfunction were fasting blood sugar (FBS) above 120 mg/dL.

Anthropometric measurements

Height and weight were measured to the nearest 0.1 cm and 0.5 kg, respectively. Body mass index (BMI) was calculated with the formula: Weight (kg)/height (m 2 ).

Laboratory measurements

Blood glucose monitoring was done by glucose oxidase-peroxidase, end point assay method using Span Diagnostic Kits, Gujarat.

Determination of genotypes

All the responders of antihypertensive medication were genotyped for IRS-1 and E23K gene polymorphism. The blood samples (5 ml) were collected in the ethylenediaminetetraacetic acid (EDTA) coated tubes and processed for isolation of DNA. DNA was extracted with a DNA extraction kit from (Bengaluru Genei, Bengaluru) as described in the manufacturer's protocol. The quantified DNA was diluted to final concentration of 25 ng/μl in Tris-EDTA buffer (10 mM Tris Cl, 1 mM EDTA, pH 8.0).

Genotyping for insulin receptor substrate-1 gene polymorphism

DNA samples of study subjects were genotyped for Gly972Arg polymorphism of IRS-1 gene using forward primer 5'- GCAGCCTGGCAGGAGAGCACT- 3' and reverse primer 5'- CTCACCTCCTCTGCAGCAATG - 3'. Polymerase chain reaction (PCR) reactions were performed in final volume of 25 μl containing ×10 assay buffer (Bangalore Genei), 0.5 units of Taq DNA polymerase (Bangalore Genei), 200 μmole of each deoxynucleotide triphosphates (dNTP's) (Bangalore Genei), 10 pmole/reaction of each forward and reverse primers and 50 ng of template DNA. Initial denaturation for 6 min at 94°C, followed by 35 cycles for denaturation for 1 min at 94°C, primer annealing for 1 min at 61.3°C and extension for 30 s at 72°C. The amplified DNA fragments were digested using 10 μl of PCR product with 3U of BstN I (CC/WGG). The digestion mixture was incubated at 56°C for 1 h. [30]

Genotyping for Kir 6.2 gene polymorphism

DNA samples of study subjects were genotyped for E23K polymorphism using forward Primer 5'- CAGTTGCCTTTCTTGGACACAAA-3' and Reverse 5'- CCGAGGAATACGTGCTGACA-3'. PCR reactions were performed in final volume of 25 μl containing ×10 assay buffer (Bangalore Genei), 0.5 units of Taq DNA polymerase (Bangalore Genei), 200 μmole of each dNTP's (Bangalore Genei), 10 pmole/reaction of each forward and reverse primers and 50 ng of template DNA. [31] Initial denaturation for 6 min at 94°C, 35 amplification cycles were performed with denaturation for 1 min at 94°C, primer annealing for 1 min at 67°C and extension for 30 s at 72°C. The amplified DNA fragments were digested using 10 μl of PCR product with 3U of Ban II (GRGCY/C). [31]

Finally, the digested PCR products were analyzed on a 1% agarose gel after an electrophoresis at a constant voltage of 100 V for 90 min.

Genotype analysis

Amplification of IRS-1 yielded a product of 220 bp. Digestion of IRS-1 gene amplification product yielded two fragments of 164 bp and 56 bp in the presence of the variant "A" allele [Figure 1]. The wild type allele "G" was not digested by BstN1. Thus, homozygous GG showed only one band, homozygous AA yielded two fragments of 164 bp and 56 bp and heterozygous GA all three bands.
Figure 1: Agarose gel photograph for Insulin Receptor Substrate 1 gene polymorphism

Click here to view


In case of Kir 6.2 gene polymorphism a 218 bp fragment containing the SNP site was amplified. Digestion of IRS-1 gene product, in presence of wild type allele E, that is, GAG; yielded two fragments of 178 bp and 40 bp. The product was not digested in homozygous variant polymorphic allele. Heterozygous genotype showed both digested and intact gene products [Figure 2].
Figure 2: Agarose gel photograph for Kir 6.2 gene polymorphism

Click here to view


Statistical analysis

Nonparametric tests were used as the data were not normally distributed. Baseline characteristics were compared between normo-glycemic and hyperglycemic patients using Chi-square test. Allelic distribution was analyzed using Hardy-Weinberg calculator. All the statistical analyses were performed using  SPSS 17 (IBM, USA).


   Results Top


A total of 150 patients (86 male, and 64 female) with primary hypertension were recruited. The anthropometric measurements of these patients were recorded [Table 1] before the study. Of the 150 patients recruited for the study initially 50 were found to be non-responders, hence were not analyzed any further. Of the 100 responders who continued on atenolol therapy, 27 patients were found associated with significant increase in FBS when they were compared with another 73 responders (P < 0.0001). Among these, 27 patients who showed increase in FBS 17 were male and 10 were female. Average onset time was found to be 5-6 months. [Table 2] summarizes comparison of mean age, BMI, FBS, gender-wise differences among the patients with and without metabolic dysfunction after 12 months of treatment.
Table 1: The baseline anthropometric and clinical characteristics of recruited patients


Click here to view
Table 2: Comparison of different anthropometric and clinical characteristics between postatenolol treated hypertensive patients with and without metabolic dysfunction n number of patients


Click here to view


Genotyping study of the responder patients did not reveal any significant difference in allelic frequencies for IRS-1 (Gly972Arg) and pancreatic ATP-sensitive potassium channel Kir 6.2 (E23K) variants among the two sexes, thus the data were pooled for further analysis [Table 3] and [Table 4].
Table 3: Allelic distribution of IRS-1 G972A polymorphism among responders to atenolol


Click here to view
Table 4: Allelic distribution of Kir 6.2 E23K polymorphism among responders to atenolol


Click here to view


Further a Comparison of genotypes and allelic distribution of IRS-1 gene and Kir 6.2 gene in atenolol treated hypertensive patients with respect to age, BMI, systolic and diastolic BP and FBS before and after treatment revealed no significant difference [Table 5], [Table 6], [Table 7], [Table 8].
Table 5: Comparison of different anthropometricand clinical parameters between atenolol treated hypertensive patients with and without metabolic dysfunction amongst different genotypes of IRS1 G927A alleles


Click here to view
Table 6: Comparison of different clinical parameters between atenolol treated hypertensive patients with and without metabolic dysfunction amongst different genotypes of Kir 6.2 E23K alleles


Click here to view
Table 7: Comparative allelic distribution of IRS-1 genes among post atenolol treated hypertensive patients with and without metabolic dysfunction


Click here to view
Table 8: Comparative allelic distribution of Kir 6.2 genes among post atenolol treated hypertensive patients with and without metabolic dysfunction


Click here to view



   Discussion Top


In this study, 27 responders of a total of 100 responders of atenolol therapy showed a significant increase in FBS and were classified as having developed metabolic dysfunction after atenolol treatment.

Among the causation of metabolic dysfunction, β1 blocker have been reported to induce disturbance in glucose metabolism resulting in weight gain. [18] However in this study, the risk of new onset of type-2 diabetes mellitus with atenolol therapy was found to be independent of age, BMI and sex of patients. Further role of genetic variations was investigated. Many candidate genes for type-2 diabetes have been proposed based on their role in insulin action or insulin resistance. [17],[18],[32],[33] As, it was first study in Indian population to study genetic basis of this problem, a prospective study was planned to delineate the role of polymorphism of two key candidate genes IRS-1 and pancreatic ATP-sensitive potassium channel Kir 6.2 in the hypertensive patients responding to atenolol for control of hypertension.

One of the most commonly studied SNP rs 1801278 in the IRS-1 gene at codon 972, causes a missense change from glycine (GGG) to arginine (AGG). [23],[24] resulting in three possible genotypes (Gly/Gly, Arg/Arg, Gly/Arg). This SNP is located within a tyrosine phosphorylation motif in the IRS-1 gene thus having functional significance for post translational modification of the protein. No Gly/Arg heterozygous patient was observed in the group with elevated FBS. However, it was observed that patients with Gly as residue 972 as in case of genotypes Gly/Gly and Arg/Arg; a significant increase in FBS was recorded [Table 5]. A further perusal of allele distribution amongst such patients did not reveal a significant difference between patients with and without elevated FBS [Table 7]. Thus keeping the question of phramacogenetic effect unresolved.

The second gene Kir 6.2 was studied for rs 5219 a missense SNP (GAG → AAG) located in the cytosolic proximal (5') N- terminal of the Kir 6.2 subunit that results in the substitution of glutamate (E) with lysine (K) at position 23 in the amino acid chain. [29] The three possible genotypes (E/E, E/K, K/K) were observed among the population of Sriganganagar, Rajasthan. It was found that both homozygous E/E and K/K variants shows a significant increase in FBS but no heterozygote E/K genotype was observed among this group [Table 6]. As no significant difference was observed between hyperglycemic and normoglycemic subjects after treatment with atenolol [Table 8] with respect to distribution of polymorphic alleles for rs 5219, it does not provide conclusive evidence for any correlation.


   Conclusion Top


This study revealed significant risk for the onset of metabolic dysfunction in the form of elevated FBS in hypertensive patients treated with atenolol, a beta-adrenergic blocking agent within 5-6 months of treatment. However, the SNPs of IRS-1 (Gly972Arg) and pancreatic ATP-sensitive potassium channel Kir 6.2 (E23K) genes did not show any correlation with incidence of hyperglycemia due to antihypertensive therapy with atenolol in this population. However, it needs to be further investigated with other genes from the beta-adrenergic pathway, so that hypertensive patients can be stratified based on their genotype for safe therapy with atenolol.

 
   References Top

1.Ferrannini E, Buzzigoli G, Bonadonna R, Giorico MA, Oleggini M, Graziadei L, et al. Insulin resistance in essential hypertension. N Engl J Med 1987;317:350-7.  Back to cited text no. 1
    
2.Pollare T, Lithell H, Selinus I, Berne C. Application of prazosin is associated with an increase of insulin sensitivity in obese patients with hypertension. Diabetologia 1988;31:415-20.  Back to cited text no. 2
    
3.Pollare T, Lithell H, Berne C. Insulin resistance is a characteristic feature of primary hypertension independent of obesity. Metabolism 1990;39:167-74.  Back to cited text no. 3
    
4.Reaven GM. Relationship between insulin resistance and hypertension. Diabetes Care 1991;14 Suppl 4:33-8.  Back to cited text no. 4
    
5.Sowers JR. Insulin resistance and hypertension. Am J Physiol Heart Circ Physiol 2004;286:H1597-602.  Back to cited text no. 5
    
6.Perez-Stable E, Caralis PV. Thiazide-induced disturbances in carbohydrate, lipid, and potassium metabolism. Am Heart J 1983;106:245-51.  Back to cited text no. 6
    
7.Lithell HO. Effect of antihypertensive drugs on insulin, glucose, and lipid metabolism. Diabetes Care 1991;14:203-9.  Back to cited text no. 7
    
8.Chobanian AV, Bakris GL, Black HR, Cushman WC, Green LA, Izzo JL Jr, et al. Seventh report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension 2003;42:1206-52.  Back to cited text no. 8
    
9.Pollare T, Lithell H, Selinus I, Berne C. Sensitivity to insulin during treatment with atenolol and metoprolol: A randomised, double blind study of effects on carbohydrate and lipoprotein metabolism in hypertensive patients. BMJ 1989;298:1152-7.  Back to cited text no. 9
    
10.Pollare T, Lithell H, Berne C. A comparison of the effects of hydrochlorothiazide and captopril on glucose and lipid metabolism in patients with hypertension. N Engl J Med 1989;321:868-73.  Back to cited text no. 10
    
11.Lundgren H, Björkman L, Keiding P, Lundmark S, Bengtsson C. Diabetes in patients with hypertension receiving pharmacological treatment. BMJ 1988;297:1512.  Back to cited text no. 11
    
12.Skarfors ET, Selinus KI, Lithell HO. Risk factors for developing non-insulin dependent diabetes: A 10 year follow up of men in Uppsala. BMJ 1991;303:755-60.  Back to cited text no. 12
    
13.Sowers JR. Is hypertension an insulin-resistant state? Metabolic changes associated with hypertension and antihypertensive therapy. Am Heart J 1991;122:932-5.  Back to cited text no. 13
    
14.Mykkänen L, Kuusisto J, Pyörälä K, Laakso M, Haffner SM. Increased risk of non-insulin-dependent diabetes mellitus in elderly hypertensive subjects. J Hypertens 1994;12:1425-32.  Back to cited text no. 14
    
15.Gress TW, Nieto FJ, Shahar E, Wofford MR, Brancati FL. Hypertension and antihypertensive therapy as risk factors for type 2 diabetes mellitus. Atherosclerosis Risk in Communities Study. N Engl J Med 2000;342:905-12.  Back to cited text no. 15
    
16.Chopra HK, Krishna CK, Ravinder SS, Komal KK. Non-cardiac effects of atenolol. Suppl J Assoc Physicians India 2009;57:26-8.  Back to cited text no. 16
    
17.Moller DE, Bjørbaek C, Vidal-Puig A. Candidate genes for insulin resistance. Diabetes Care 1996;19:396-400.  Back to cited text no. 17
    
18.Sacks DB, McDonald JM. The pathogenesis of type II diabetes mellitus. A polygenic disease. Am J Clin Pathol 1996;105:149-56.  Back to cited text no. 18
    
19.Morini E, Prudente S, Succurro E, Chandalia M, Zhang YY, Mammarella S, et al. IRS1 G972R polymorphism and type 2 diabetes: A paradigm for the difficult ascertainment of the contribution to disease susceptibility of 'low-frequency-low-risk' variants. Diabetologia 2009;52:1852-7.  Back to cited text no. 19
    
20.Sawicki PT, Siebenhofer A. Beta-blockers and diabetes mellitus. J Clin Basic Cardiol 2001;4:17-20.  Back to cited text no. 20
    
21.Panz VR, Raal FJ, O'Rahilly S, Kedda MA, Joffe BI. Insulin receptor substrate-1 gene variants in lipoatrophic diabetes mellitus and non-insulin-dependent diabetes mellitus: A study of South African black and white subjects. Hum Genet 1997;101:118-9.  Back to cited text no. 21
    
22.Myers MG Jr, White MF. The new elements of insulin signaling. Insulin receptor substrate-1 and proteins with SH2 domains. Diabetes 1993;42:643-50.  Back to cited text no. 22
    
23.Imai Y, Fusco A, Suzuki Y, Lesniak MA, D'Alfonso R, Sesti G, et al. Variant sequences of insulin receptor substrate-1 in patients with noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab 1994;79:1655-8.  Back to cited text no. 23
    
24.Almind K, Bjørbaek C, Vestergaard H, Hansen T, Echwald S, Pedersen O. Aminoacid polymorphisms of insulin receptor substrate-1 in non-insulin-dependent diabetes mellitus. Lancet 1993;342:828-32.  Back to cited text no. 24
    
25.Ashcroft FM, Rorsman P. Electrophysiology of the pancreatic beta-cell. Prog Biophys Mol Biol 1989;54:87-143.  Back to cited text no. 25
    
26.Reimann F, Gribble FM. Glucose-sensing in glucagon-like peptide-1-secreting cells. Diabetes 2002;51:2757-63.  Back to cited text no. 26
    
27.Inagaki N, Gonoi T, Clement JP 4 th , Namba N, Inazawa J, Gonzalez G, et al. Reconstitution of IKATP: An inward rectifier subunit plus the sulfonylurea receptor. Science 1995;270:1166-70.  Back to cited text no. 27
    
28.Aguilar-Bryan L, Nichols CG, Wechsler SW, Clement JP 4 th , Boyd AE 3 rd , González G, et al. Cloning of the beta cell high-affinity sulfonylurea receptor: A regulator of insulin secretion. Science 1995;268:423-6.  Back to cited text no. 28
    
29.Riedel MJ, Steckley DC, Light PE. Current status of the E23K Kir6.2 polymorphism: Implications for type-2 diabetes. Hum Genet 2005;116:133-45.  Back to cited text no. 29
    
30.Lei HH, Coresh J, Shuldiner AR, Boerwinkle E, Brancati FL. Variants of the insulin receptor substrate-1 and fatty acid binding protein 2 genes and the risk of type 2 diabetes, obesity, and hyperinsulinemia in African-Americans: The Atherosclerosis Risk in Communities Study. Diabetes 1999;48:1868-72.  Back to cited text no. 30
    
31.Shaat N, Ekelund M, Lernmark A, Ivarsson S, Almgren P, Berntorp K, et al. Association of the E23K polymorphism in the KCNJ11 gene with gestational diabetes mellitus. Diabetologia 2005;48:2544-51.  Back to cited text no. 31
    
32.Seino S. Recent progress in the molecular genetic aspects of non-insulin-dependent diabetes mellitus. Intern Med 1996;35:347-55.  Back to cited text no. 32
    
33.Groop LC. The molecular genetics of non-insulin-dependent diabetes mellitus. J Intern Med 1997;241:95-101.  Back to cited text no. 33
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6], [Table 7], [Table 8]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and me...
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed3318    
    Printed121    
    Emailed0    
    PDF Downloaded234    
    Comments [Add]    

Recommend this journal